Stem-loop sequence bta-mir-2285cl

AccessionMI0038406 (change log)
DescriptionBos taurus miR-2285cl stem-loop
Literature search

11 open access papers mention bta-mir-2285cl
(15 sentences)

Stem-loop
   --u       a   -        -a g   g 
5'    aaaguuc uuc ggguuuuu  u uag a
      ||||||| ||| ||||||||  | |||  
3'    uuucaag gag cccaaaaa  g auu u
   auu       -   a        ag g   c 
Get sequence
Deep sequencing
162 reads, 0 reads per million, 18 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Btau_5.0.1; GCA_000003205.6) Overlapping transcripts
chr28: 33612084-33612142 [+]
intergenic
Database links

Mature sequence bta-miR-2285cl

Accession MIMAT0046681
Sequence

1 - 

uaaaguucauucggguuuuu

 - 20

Get sequence
Deep sequencing101 reads, 23 experiments
Evidence experimental; Illumina [1]

References

1
PMID:26519053 "Deep sequencing shows microRNA involvement in bovine mammary gland adaptation to diets supplemented with linseed oil or safflower oil" Li R, Beaudoin F, Ammah AA, Bissonnette N, Benchaar C, Zhao X, Lei C, Ibeagha-Awemu EM BMC Genomics. 16:884(2015).