Stem-loop sequence bta-mir-2285ck

AccessionMI0038401 (change log)
DescriptionBos taurus miR-2285ck stem-loop
Literature search

11 open access papers mention bta-mir-2285ck
(15 sentences)

Stem-loop
   --         uc       c   -   uc    a 
5'   uggccaaaa  uuuguuu agu uuu  caua c
     |||||||||  ||||||| ||| |||  ||||  
3'   accgguuuu  aaacaag uca aaa  guau a
   ca         uc       c   c   cc    g 
Get sequence
Deep sequencing
171 reads, 0 reads per million, 57 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Btau_5.0.1; GCA_000003205.6) Overlapping transcripts
chr16: 45922350-45922418 [+]
intergenic
Database links

Mature sequence bta-miR-2285ck

Accession MIMAT0046676
Sequence

1 - 

uggccaaaaucuuuguuucagu

 - 22

Get sequence
Deep sequencing4 reads, 4 experiments
Evidence experimental; Illumina [1]

References

1
PMID:26519053 "Deep sequencing shows microRNA involvement in bovine mammary gland adaptation to diets supplemented with linseed oil or safflower oil" Li R, Beaudoin F, Ammah AA, Bissonnette N, Benchaar C, Zhao X, Lei C, Ibeagha-Awemu EM BMC Genomics. 16:884(2015).