Stem-loop sequence bta-mir-2285cj

AccessionMI0038399 (change log)
DescriptionBos taurus miR-2285cj stem-loop
Literature search

11 open access papers mention bta-mir-2285cj
(15 sentences)

Stem-loop
   ---            g            ag 
5'    aaaaguucguuu gguuuuucugua  a
      |||||||||||| ||||||||||||   
3'    uuuucaaguaag ucaaaaagguau  u
   ugu            g            gg 
Get sequence
Deep sequencing
8554 reads, 149 reads per million, 77 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Btau_5.0.1; GCA_000003205.6) Overlapping transcripts
chrX: 23238008-23238066 [+]
intergenic
Database links

Mature sequence bta-miR-2285cj

Accession MIMAT0046674
Sequence

38 - 

aaaacuggaaugaacuuuuugu

 - 59

Get sequence
Deep sequencing2687 reads, 77 experiments
Evidence experimental; Illumina [1]

References

1
PMID:26519053 "Deep sequencing shows microRNA involvement in bovine mammary gland adaptation to diets supplemented with linseed oil or safflower oil" Li R, Beaudoin F, Ammah AA, Bissonnette N, Benchaar C, Zhao X, Lei C, Ibeagha-Awemu EM BMC Genomics. 16:884(2015).