Stem-loop sequence bta-mir-2285ch

AccessionMI0038396 (change log)
DescriptionBos taurus miR-2285ch stem-loop
Literature search

11 open access papers mention bta-mir-2285ch
(15 sentences)

Stem-loop
   --                 u  gc     uau 
5'   uggccaaaaaguucguu ga  uuucu   a
     ||||||||||||||||| ||  |||||    
3'   accgguuuuucaaguaa cu  aaagg   c
   cg                 -  -a     uac 
Get sequence
Deep sequencing
532 reads, 0 reads per million, 52 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Btau_5.0.1; GCA_000003205.6) Overlapping transcripts
chr1: 123739555-123739616 [+]
intergenic
Database links

Mature sequence bta-miR-2285ch

Accession MIMAT0046671
Sequence

41 - 

aucaaugaacuuuuuggccagc

 - 62

Get sequence
Deep sequencing65 reads, 40 experiments
Evidence experimental; Illumina [1]

References

1
PMID:26519053 "Deep sequencing shows microRNA involvement in bovine mammary gland adaptation to diets supplemented with linseed oil or safflower oil" Li R, Beaudoin F, Ammah AA, Bissonnette N, Benchaar C, Zhao X, Lei C, Ibeagha-Awemu EM BMC Genomics. 16:884(2015).