Stem-loop sequence bta-mir-148d

AccessionMI0038395 (change log)
DescriptionBos taurus miR-148d stem-loop
Literature search

16 open access papers mention bta-mir-148d
(27 sentences)

Stem-loop
   ---         ua ug a       cu uc 
5'    aaaguucug  g  c cugacuu  a  a
      |||||||||  |  | |||||||  |   
3'    uuucaagac  u  g ggcugag  u  u
   ccg         uc gu a       ac ua 
Get sequence
Deep sequencing
2 reads, 0 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Btau_5.0.1; GCA_000003205.6) Overlapping transcripts
chr4: 70663559-70663619 [-]
intergenic
Clustered miRNAs
< 10kb from bta-mir-148d
bta-mir-148dchr4: 70663559-70663619 [-]
bta-mir-148achr4: 70663557-70663624 [+]
Database links

Mature sequence bta-miR-148d

Accession MIMAT0046670
Sequence

1 - 

aaaguucuguagugcacugacu

 - 22

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:26519053 "Deep sequencing shows microRNA involvement in bovine mammary gland adaptation to diets supplemented with linseed oil or safflower oil" Li R, Beaudoin F, Ammah AA, Bissonnette N, Benchaar C, Zhao X, Lei C, Ibeagha-Awemu EM BMC Genomics. 16:884(2015).