Stem-loop sequence bta-mir-299-2

AccessionMI0038394 (change log)
DescriptionBos taurus miR-299-2 stem-loop
Stem-loop
   -c                     au 
5'   gguuuaccgucccacauacau  u
     |||||||||||||||||||||  c
3'   ccaaauggcaggguguaugua  a
   ua                     ag 
Get sequence
Deep sequencing
558 reads, 0 reads per million, 57 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Btau_5.0.1; GCA_000003205.6) Overlapping transcripts
chr21: 67841948-67841999 [-]
intergenic
Clustered miRNAs
< 10kb from bta-mir-299-2
bta-mir-495chr21: 67851608-67851688 [+]
bta-mir-543chr21: 67850198-67850277 [+]
bta-mir-1193chr21: 67848381-67848485 [+]
bta-mir-494chr21: 67848049-67848133 [+]
bta-mir-329achr21: 67845190-67845272 [+]
bta-mir-329bchr21: 67844880-67844962 [+]
bta-mir-758chr21: 67844139-67844226 [+]
bta-mir-323chr21: 67843841-67843926 [+]
bta-mir-1197chr21: 67843672-67843768 [+]
bta-mir-411bchr21: 67843330-67843404 [+]
bta-mir-380chr21: 67843176-67843236 [+]
bta-mir-299-2chr21: 67841948-67841999 [-]
bta-mir-299chr21: 67841943-67842005 [+]
bta-mir-411achr21: 67841471-67841552 [+]
bta-mir-379chr21: 67840242-67840327 [+]
Database links

Mature sequence bta-miR-299-2

Accession MIMAT0046669
Sequence

32 - 

guaugugggacgguaaaccau

 - 52

Get sequence
Deep sequencing118 reads, 37 experiments
Evidence experimental; Illumina [1]

References

1
PMID:26519053 "Deep sequencing shows microRNA involvement in bovine mammary gland adaptation to diets supplemented with linseed oil or safflower oil" Li R, Beaudoin F, Ammah AA, Bissonnette N, Benchaar C, Zhao X, Lei C, Ibeagha-Awemu EM BMC Genomics. 16:884(2015).