Stem-loop sequence bta-mir-2285cg

AccessionMI0038389 (change log)
DescriptionBos taurus miR-2285cg stem-loop
Literature search

11 open access papers mention bta-mir-2285cg
(15 sentences)

Stem-loop
   --       -     a        ca   g 
5'   aaaaguu cauuc gguuuuuc  uaa a
     ||||||| ||||| ||||||||  |||  
3'   uuuucaa guaag ccaaaaag  auu u
   ag       a     a        ac   g 
Get sequence
Deep sequencing
406 reads, 18.6 reads per million, 70 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Btau_5.0.1; GCA_000003205.6) Overlapping transcripts
chr24: 50706686-50706744 [-]
intergenic
Database links

Mature sequence bta-miR-2285cg

Accession MIMAT0046665
Sequence

38 - 

aaaaccagaaugaaacuuuuga

 - 59

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:26519053 "Deep sequencing shows microRNA involvement in bovine mammary gland adaptation to diets supplemented with linseed oil or safflower oil" Li R, Beaudoin F, Ammah AA, Bissonnette N, Benchaar C, Zhao X, Lei C, Ibeagha-Awemu EM BMC Genomics. 16:884(2015).