Stem-loop sequence bta-mir-2285ce

AccessionMI0038381 (change log)
DescriptionBos taurus miR-2285ce stem-loop
Literature search

11 open access papers mention bta-mir-2285ce
(15 sentences)

Stem-loop
   ---       ug  ug        -   aa 
5'    aaaaguu  uu  gguuuuuc ugu  g
      |||||||  ||  |||||||| |||   
3'    uuuucaa  aa  ccaaaagg aua  c
   agu       gu  gu        u   cu 
Get sequence
Deep sequencing
11018 reads, 184 reads per million, 77 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Btau_5.0.1; GCA_000003205.6) Overlapping transcripts
chr29: 29745971-29746028 [+]
intergenic
Database links

Mature sequence bta-miR-2285ce

Accession MIMAT0046657
Sequence

36 - 

gaaaaccugaaugaacuuuuuga

 - 58

Get sequence
Deep sequencing10648 reads, 77 experiments
Evidence experimental; Illumina [1]

References

1
PMID:26519053 "Deep sequencing shows microRNA involvement in bovine mammary gland adaptation to diets supplemented with linseed oil or safflower oil" Li R, Beaudoin F, Ammah AA, Bissonnette N, Benchaar C, Zhao X, Lei C, Ibeagha-Awemu EM BMC Genomics. 16:884(2015).