Stem-loop sequence bta-mir-1264

AccessionMI0038380 (change log)
DescriptionBos taurus miR-1264 stem-loop
Literature search

1 open access papers mention bta-mir-1264
(1 sentences)

Stem-loop
   --    c     -    u        caagaa 
5'   aggu cucaa uaag auuuguug      u
     |||| ||||| |||| ||||||||      a
3'   ucca gaguu auuc ugaacaac      a
   ug    c     u    -        caagag 
Get sequence
Deep sequencing
3 reads, 0 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Btau_5.0.1; GCA_000003205.6) Overlapping transcripts
chrX: 68668048-68668110 [+]
intergenic
Database links

Mature sequence bta-miR-1264

Accession MIMAT0046656
Sequence

42 - 

caagucuuauuugagcaccugu

 - 63

Get sequence
Deep sequencing2 reads, 1 experiments
Evidence experimental; Illumina [1]

References

1
PMID:26519053 "Deep sequencing shows microRNA involvement in bovine mammary gland adaptation to diets supplemented with linseed oil or safflower oil" Li R, Beaudoin F, Ammah AA, Bissonnette N, Benchaar C, Zhao X, Lei C, Ibeagha-Awemu EM BMC Genomics. 16:884(2015).