Stem-loop sequence bta-mir-2285cd

AccessionMI0038379 (change log)
DescriptionBos taurus miR-2285cd stem-loop
Literature search

11 open access papers mention bta-mir-2285cd
(15 sentences)

Stem-loop
   --            ug    uug    - a 
5'   aaaaaguucguu  gguu   cugu c c
     ||||||||||||  ||||   |||| | a
3'   uuuuucaaguag  ccaa   ggua g c
   gg            gu    caa    u u 
Get sequence
Deep sequencing
13410 reads, 45.9 reads per million, 74 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Btau_5.0.1; GCA_000003205.6) Overlapping transcripts
chr8: 22097434-22097493 [-]
intergenic
Database links

Mature sequence bta-miR-2285cd

Accession MIMAT0046655
Sequence

38 - 

aacaaccuggaugaacuuuuugg

 - 60

Get sequence
Deep sequencing120 reads, 53 experiments
Evidence experimental; Illumina [1]

References

1
PMID:26519053 "Deep sequencing shows microRNA involvement in bovine mammary gland adaptation to diets supplemented with linseed oil or safflower oil" Li R, Beaudoin F, Ammah AA, Bissonnette N, Benchaar C, Zhao X, Lei C, Ibeagha-Awemu EM BMC Genomics. 16:884(2015).