Stem-loop sequence bta-mir-2285cc

AccessionMI0038376 (change log)
DescriptionBos taurus miR-2285cc stem-loop
Literature search

11 open access papers mention bta-mir-2285cc
(15 sentences)

Stem-loop
   --     -      g       ---c    a 
5'   aaaag uucauu ggguuuu    caua c
     ||||| |||||| |||||||    ||||  
3'   uuuuc aaguaa uccaaaa    gugu a
   ag     c      g       agac    u 
Get sequence
Deep sequencing
4632 reads, 26.4 reads per million, 72 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Btau_5.0.1; GCA_000003205.6) Overlapping transcripts
chr13: 42541803-42541860 [-]
intergenic
Database links

Mature sequence bta-miR-2285cc

Accession MIMAT0046652
Sequence

36 - 

aaaaaccugaaugaaccuuuuga

 - 58

Get sequence
Deep sequencing4582 reads, 72 experiments
Evidence experimental; Illumina [1]

References

1
PMID:26519053 "Deep sequencing shows microRNA involvement in bovine mammary gland adaptation to diets supplemented with linseed oil or safflower oil" Li R, Beaudoin F, Ammah AA, Bissonnette N, Benchaar C, Zhao X, Lei C, Ibeagha-Awemu EM BMC Genomics. 16:884(2015).