Stem-loop sequence bta-mir-2285cb

AccessionMI0038375 (change log)
DescriptionBos taurus miR-2285cb stem-loop
Literature search

11 open access papers mention bta-mir-2285cb
(15 sentences)

Stem-loop
   -a                u    g   u 
5'   aaaaguucguuugggu uuuu uaa a
     |||||||||||||||| |||| ||| u
3'   uuuucaaguaggccca aaaa guu g
   gg                c    a   u 
Get sequence
Deep sequencing
13324 reads, 45.1 reads per million, 71 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Btau_5.0.1; GCA_000003205.6) Overlapping transcripts
chr19: 41582164-41582221 [-]
intergenic
Database links

Mature sequence bta-miR-2285cb

Accession MIMAT0046651
Sequence

38 - 

aacacccggaugaacuuuugg

 - 58

Get sequence
Deep sequencing2 reads, 2 experiments
Evidence experimental; Illumina [1]

References

1
PMID:26519053 "Deep sequencing shows microRNA involvement in bovine mammary gland adaptation to diets supplemented with linseed oil or safflower oil" Li R, Beaudoin F, Ammah AA, Bissonnette N, Benchaar C, Zhao X, Lei C, Ibeagha-Awemu EM BMC Genomics. 16:884(2015).