Stem-loop sequence bta-mir-2285by

AccessionMI0038369 (change log)
DescriptionBos taurus miR-2285by stem-loop
Literature search

11 open access papers mention bta-mir-2285by
(15 sentences)

Stem-loop
           gg  g         gcaca 
5' aaaaguuu  uu gguuuuucu     a
   ||||||||  || |||||||||      
3' uuuucaag  ag ccaaaaaga     u
           ag  a         aauuc 
Get sequence
Deep sequencing
74 reads, 0 reads per million, 25 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Btau_5.0.1; GCA_000003205.6) Overlapping transcripts
chr7: 20841273-20841328 [+]
intergenic
Database links

Mature sequence bta-miR-2285by

Accession MIMAT0046645
Sequence

1 - 

aaaaguuugguuggguuuuucu

 - 22

Get sequence
Deep sequencing74 reads, 25 experiments
Evidence experimental; Illumina [1]

References

1
PMID:26519053 "Deep sequencing shows microRNA involvement in bovine mammary gland adaptation to diets supplemented with linseed oil or safflower oil" Li R, Beaudoin F, Ammah AA, Bissonnette N, Benchaar C, Zhao X, Lei C, Ibeagha-Awemu EM BMC Genomics. 16:884(2015).