Stem-loop sequence bta-mir-2285bx

AccessionMI0038368 (change log)
DescriptionBos taurus miR-2285bx stem-loop
Literature search

11 open access papers mention bta-mir-2285bx
(15 sentences)

Stem-loop
   ---        g    au       uaag 
5'    aaaaguuc uucg  uuuuccu    a
      |||||||| ||||  |||||||    u
3'    uuuucaag aagc  aaaaggg    u
   guu        g    cc       caua 
Get sequence
Deep sequencing
100 reads, 0 reads per million, 20 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Btau_5.0.1; GCA_000003205.6) Overlapping transcripts
chr15: 45103398-45103455 [+]
intergenic
Database links

Mature sequence bta-miR-2285bx

Accession MIMAT0046644
Sequence

1 - 

aaaaguucguucgauuuuuccu

 - 22

Get sequence
Deep sequencing57 reads, 6 experiments
Evidence experimental; Illumina [1]

References

1
PMID:26519053 "Deep sequencing shows microRNA involvement in bovine mammary gland adaptation to diets supplemented with linseed oil or safflower oil" Li R, Beaudoin F, Ammah AA, Bissonnette N, Benchaar C, Zhao X, Lei C, Ibeagha-Awemu EM BMC Genomics. 16:884(2015).