Stem-loop sequence bta-mir-2285bw

AccessionMI0038367 (change log)
DescriptionBos taurus miR-2285bw stem-loop
Literature search

11 open access papers mention bta-mir-2285bw
(15 sentences)

Stem-loop
   --          g      c   aau 
5'   aaguucauuu gguuuu cug   a
     |||||||||| |||||| |||   u
3'   uucaaguaaa ccaaaa gac   c
   uu          g      a   auu 
Get sequence
Deep sequencing
63 reads, 0 reads per million, 28 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Btau_5.0.1; GCA_000003205.6) Overlapping transcripts
chr14: 36312363-36312415 [-]
intergenic
Database links

Mature sequence bta-miR-2285bw

Accession MIMAT0046643
Sequence

32 - 

agaaaaaccgaaaugaacuuuu

 - 53

Get sequence
Deep sequencing61 reads, 27 experiments
Evidence experimental; Illumina [1]

References

1
PMID:26519053 "Deep sequencing shows microRNA involvement in bovine mammary gland adaptation to diets supplemented with linseed oil or safflower oil" Li R, Beaudoin F, Ammah AA, Bissonnette N, Benchaar C, Zhao X, Lei C, Ibeagha-Awemu EM BMC Genomics. 16:884(2015).