Stem-loop sequence bta-mir-2285bv

AccessionMI0038366 (change log)
DescriptionBos taurus miR-2285bv stem-loop
Literature search

11 open access papers mention bta-mir-2285bv
(15 sentences)

Stem-loop
   --            ga      g   u 
5'   aauguuuguuug  uguuuu uaa a
     ||||||||||||  |||||| |||  
3'   uuacaaacaagc  acaaaa auu g
   uu            uc      g   c 
Get sequence
Deep sequencing
10 reads, 0 reads per million, 3 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Btau_5.0.1; GCA_000003205.6) Overlapping transcripts
chr7: 111951709-111951762 [+]
intergenic
Database links

Mature sequence bta-miR-2285bv

Accession MIMAT0046642
Sequence

33 - 

aaaacacucgaacaaacauuuu

 - 54

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:26519053 "Deep sequencing shows microRNA involvement in bovine mammary gland adaptation to diets supplemented with linseed oil or safflower oil" Li R, Beaudoin F, Ammah AA, Bissonnette N, Benchaar C, Zhao X, Lei C, Ibeagha-Awemu EM BMC Genomics. 16:884(2015).