Stem-loop sequence bta-mir-2285bu-2

AccessionMI0038365 (change log)
DescriptionBos taurus miR-2285bu-2 stem-loop
Literature search

11 open access papers mention bta-mir-2285bu-2
(15 sentences)

Stem-loop
   --     -  ug  ug        caaaa 
5'   aagaa uu  uu  gguuuuuc     g
     ||||| ||  ||  ||||||||     a
3'   uuuuu aa  aa  ccagaaag     u
   gg     c  gu  gu        uauug 
Get sequence
Deep sequencing
5357 reads, 37 reads per million, 73 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Btau_5.0.1; GCA_000003205.6) Overlapping transcripts
chr4: 63416641-63416698 [-]
intergenic
Database links

Mature sequence bta-miR-2285bu

Accession MIMAT0046640
Sequence

37 - 

aagaccugaaugaacuuuuugg

 - 58

Get sequence
Deep sequencing10698 reads, 74 experiments
Evidence experimental; Illumina [1]

References

1
PMID:26519053 "Deep sequencing shows microRNA involvement in bovine mammary gland adaptation to diets supplemented with linseed oil or safflower oil" Li R, Beaudoin F, Ammah AA, Bissonnette N, Benchaar C, Zhao X, Lei C, Ibeagha-Awemu EM BMC Genomics. 16:884(2015).