Stem-loop sequence bta-mir-2285bu-1

AccessionMI0038364 (change log)
DescriptionBos taurus miR-2285bu-1 stem-loop
Literature search

11 open access papers mention bta-mir-2285bu-1
(15 sentences)

Stem-loop
   --      g              g   cag 
5'   aaaaag ucguucggguuuuu uag   a
     |||||| |||||||||||||| |||    
3'   uuuuuc aguaaguccagaaa guc   u
   gg      a              g   uug 
Get sequence
Deep sequencing
10912 reads, 54.7 reads per million, 75 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Btau_5.0.1; GCA_000003205.6) Overlapping transcripts
chr13: 60619752-60619811 [-]
intergenic
Database links

Mature sequence bta-miR-2285bu

Accession MIMAT0046640
Sequence

39 - 

aagaccugaaugaacuuuuugg

 - 60

Get sequence
Deep sequencing10698 reads, 74 experiments
Evidence experimental; Illumina [1]

References

1
PMID:26519053 "Deep sequencing shows microRNA involvement in bovine mammary gland adaptation to diets supplemented with linseed oil or safflower oil" Li R, Beaudoin F, Ammah AA, Bissonnette N, Benchaar C, Zhao X, Lei C, Ibeagha-Awemu EM BMC Genomics. 16:884(2015).