Stem-loop sequence bta-mir-2285bt

AccessionMI0038363 (change log)
DescriptionBos taurus miR-2285bt stem-loop
Literature search

11 open access papers mention bta-mir-2285bt
(15 sentences)

Stem-loop
   -a        a     guug       c 
5'   aaaaguuc uuugg    ucuguaa a
     |||||||| |||||    |||||||  
3'   uuuucaag aaacc    agguauu u
   gg        c     aaaa       c 
Get sequence
Deep sequencing
6697 reads, 22.1 reads per million, 68 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Btau_5.0.1; GCA_000003205.6) Overlapping transcripts
chr21: 62129493-62129549 [-]
intergenic
Database links

Mature sequence bta-miR-2285bt

Accession MIMAT0046639
Sequence

1 - 

aaaaaguucauuuggguugucu

 - 22

Get sequence
Deep sequencing6687 reads, 67 experiments
Evidence experimental; Illumina [1]

References

1
PMID:26519053 "Deep sequencing shows microRNA involvement in bovine mammary gland adaptation to diets supplemented with linseed oil or safflower oil" Li R, Beaudoin F, Ammah AA, Bissonnette N, Benchaar C, Zhao X, Lei C, Ibeagha-Awemu EM BMC Genomics. 16:884(2015).