Stem-loop sequence bta-mir-2285bs

AccessionMI0038361 (change log)
DescriptionBos taurus miR-2285bs stem-loop
Literature search

11 open access papers mention bta-mir-2285bs
(15 sentences)

Stem-loop
   -         ug  ug    uuu  aucgc 
5'  caaaaaguu  uu  gguu   cc     a
    |||||||||  ||  ||||   ||     u
3'  guuuuucaa  ag  ccaa   gg     c
   g         gu  gu    -uc  acauu 
Get sequence
Deep sequencing
10126 reads, 45.2 reads per million, 73 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Btau_5.0.1; GCA_000003205.6) Overlapping transcripts
chr1: 1005437-1005497 [-]
intergenic
Database links

Mature sequence bta-miR-2285bs

Accession MIMAT0046637
Sequence

40 - 

cuaaccuggaugaacuuuuugg

 - 61

Get sequence
Deep sequencing68 reads, 40 experiments
Evidence experimental; Illumina [1]

References

1
PMID:26519053 "Deep sequencing shows microRNA involvement in bovine mammary gland adaptation to diets supplemented with linseed oil or safflower oil" Li R, Beaudoin F, Ammah AA, Bissonnette N, Benchaar C, Zhao X, Lei C, Ibeagha-Awemu EM BMC Genomics. 16:884(2015).