Stem-loop sequence bta-mir-2285br

AccessionMI0038360 (change log)
DescriptionBos taurus miR-2285br stem-loop
Literature search

11 open access papers mention bta-mir-2285br
(15 sentences)

Stem-loop
   --        g   ug a      cauugc 
5'   agaaaguu guu  g uuuuuc      a
     |||||||| |||  | ||||||       
3'   ucuuucaa uaa  c aaaaag      u
   ug        g   gu c      acauuc 
Get sequence
Deep sequencing
7850 reads, 57.5 reads per million, 73 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Btau_5.0.1; GCA_000003205.6) Overlapping transcripts
chr8: 78063391-78063450 [+]
intergenic
Database links

Mature sequence bta-miR-2285br

Accession MIMAT0046636
Sequence

39 - 

aaaaccugaaugaacuuucugu

 - 60

Get sequence
Deep sequencing7724 reads, 73 experiments
Evidence experimental; Illumina [1]

References

1
PMID:26519053 "Deep sequencing shows microRNA involvement in bovine mammary gland adaptation to diets supplemented with linseed oil or safflower oil" Li R, Beaudoin F, Ammah AA, Bissonnette N, Benchaar C, Zhao X, Lei C, Ibeagha-Awemu EM BMC Genomics. 16:884(2015).