Stem-loop sequence bta-mir-2285bq

AccessionMI0038359 (change log)
DescriptionBos taurus miR-2285bq stem-loop
Literature search

11 open access papers mention bta-mir-2285bq
(15 sentences)

Stem-loop
   ----aaau        a      c  acaac 
5'         guucauuc gguuuu cu     a
           |||||||| |||||| ||      
3'         caaguaag ccaaaa ga     u
   cgguucuu        c      a  cauuc 
Get sequence
Deep sequencing
4595 reads, 164 reads per million, 66 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Btau_5.0.1; GCA_000003205.6) Overlapping transcripts
chr6: 23736734-23736793 [-]
intergenic
Database links

Mature sequence bta-miR-2285bq

Accession MIMAT0046635
Sequence

38 - 

aaaacccgaaugaacuucuuggc

 - 60

Get sequence
Deep sequencing4577 reads, 77 experiments
Evidence experimental; Illumina [1]

References

1
PMID:26519053 "Deep sequencing shows microRNA involvement in bovine mammary gland adaptation to diets supplemented with linseed oil or safflower oil" Li R, Beaudoin F, Ammah AA, Bissonnette N, Benchaar C, Zhao X, Lei C, Ibeagha-Awemu EM BMC Genomics. 16:884(2015).