Stem-loop sequence bta-mir-2285bp

AccessionMI0038357 (change log)
DescriptionBos taurus miR-2285bp stem-loop
Literature search

11 open access papers mention bta-mir-2285bp
(15 sentences)

Stem-loop
   -  a       a   a a       aaaac 
5'  ca aaaguuc uuc g uuuuucu     a
    || ||||||| ||| | |||||||      
3'  gu uuucaag aag c aaaaagg     g
   u  g       c   a c       cauuc 
Get sequence
Deep sequencing
4830 reads, 16.9 reads per million, 59 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Btau_5.0.1; GCA_000003205.6) Overlapping transcripts
chr15: 79085414-79085474 [-]
intergenic
Database links

Mature sequence bta-miR-2285bp

Accession MIMAT0046633
Sequence

40 - 

aaaaccagaacgaacuuugugu

 - 61

Get sequence
Deep sequencing2829 reads, 42 experiments
Evidence experimental; Illumina [1]

References

1
PMID:26519053 "Deep sequencing shows microRNA involvement in bovine mammary gland adaptation to diets supplemented with linseed oil or safflower oil" Li R, Beaudoin F, Ammah AA, Bissonnette N, Benchaar C, Zhao X, Lei C, Ibeagha-Awemu EM BMC Genomics. 16:884(2015).