Stem-loop sequence bta-mir-2285bo

AccessionMI0038351 (change log)
DescriptionBos taurus miR-2285bo stem-loop
Literature search

11 open access papers mention bta-mir-2285bo
(15 sentences)

Stem-loop
   u         g  c -a     -----      
5'  gaaaaguuc uu g  guuuu     ccaua 
    ||||||||| || |  |||||     |||| a
3'  uuuuucaag aa c  caaaa     gguag 
   -         g  a cc     aagau      
Get sequence
Deep sequencing
159269 reads, 812 reads per million, 77 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Btau_5.0.1; GCA_000003205.6) Overlapping transcripts
chr3: 100095317-100095374 [-]
intergenic
Database links

Mature sequence bta-miR-2285bo

Accession MIMAT0046627
Sequence

1 - 

ugaaaaguucguucgaguuuu

 - 21

Get sequence
Deep sequencing159269 reads, 77 experiments
Evidence experimental; Illumina [1]

References

1
PMID:26519053 "Deep sequencing shows microRNA involvement in bovine mammary gland adaptation to diets supplemented with linseed oil or safflower oil" Li R, Beaudoin F, Ammah AA, Bissonnette N, Benchaar C, Zhao X, Lei C, Ibeagha-Awemu EM BMC Genomics. 16:884(2015).