Stem-loop sequence bta-mir-2285bm

AccessionMI0038348 (change log)
DescriptionBos taurus miR-2285bm stem-loop
Literature search

11 open access papers mention bta-mir-2285bm
(15 sentences)

Stem-loop
   -            a  g         gag 
5'  aaaaaguucauu gg uuuuucugu   a
    |||||||||||| || |||||||||    
3'  uuuuucagguga cc aaaaaggua   u
   g            g  a         ggg 
Get sequence
Deep sequencing
2584 reads, 7.69 reads per million, 52 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Btau_5.0.1; GCA_000003205.6) Overlapping transcripts
chr16: 20708677-20708735 [-]
intergenic
Database links

Mature sequence bta-miR-2285bm

Accession MIMAT0046624
Sequence

38 - 

aaaaaaccgaguggacuuuuug

 - 59

Get sequence
Deep sequencing2078 reads, 39 experiments
Evidence experimental; Illumina [1]

References

1
PMID:26519053 "Deep sequencing shows microRNA involvement in bovine mammary gland adaptation to diets supplemented with linseed oil or safflower oil" Li R, Beaudoin F, Ammah AA, Bissonnette N, Benchaar C, Zhao X, Lei C, Ibeagha-Awemu EM BMC Genomics. 16:884(2015).