Stem-loop sequence bta-mir-2285bl

AccessionMI0038347 (change log)
DescriptionBos taurus miR-2285bl stem-loop
Literature search

11 open access papers mention bta-mir-2285bl
(15 sentences)

Stem-loop
   ---   a         ca       aagaca    a 
5'    aaa aguucauuc  guuuuuc      uauc u
      ||| |||||||||  |||||||      |||| a
3'    uuu ucaaguaag  caaaagg      guag u
   ugg   c         uc       ------    a 
Get sequence
Deep sequencing
7434 reads, 38.9 reads per million, 72 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Btau_5.0.1; GCA_000003205.6) Overlapping transcripts
chr28: 10457830-10457895 [-]
intergenic
Database links

Mature sequence bta-miR-2285bl

Accession MIMAT0046623
Sequence

44 - 

aaaaccugaaugaacucuuuggu

 - 66

Get sequence
Deep sequencing7422 reads, 73 experiments
Evidence experimental; Illumina [1]

References

1
PMID:26519053 "Deep sequencing shows microRNA involvement in bovine mammary gland adaptation to diets supplemented with linseed oil or safflower oil" Li R, Beaudoin F, Ammah AA, Bissonnette N, Benchaar C, Zhao X, Lei C, Ibeagha-Awemu EM BMC Genomics. 16:884(2015).