Stem-loop sequence xla-mir-210

AccessionMI0038294 (change log)
DescriptionXenopus laevis miR-210 stem-loop
Stem-loop
   --    a   acua       u  c  ugcug 
5'   agcc cug    acgcaca ug gc     c
     |||| |||    ||||||| || ||      
3'   ucgg gac    ugcgugu ac cg     u
   aa    c   agug       c  -  uaaaa 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (JGIv8.0) Overlapping transcripts
chr4L: 22477271-22477333 [-]
intergenic
chr4S: 27750202-27750264 [-]
intergenic
Database links

Mature sequence xla-miR-210-5p

Accession MIMAT0046530
Sequence

1 - 

agccacugacuaacgcacauug

 - 22

Get sequence
Evidence experimental; Illumina [1]

Mature sequence xla-miR-210-3p

Accession MIMAT0046531
Sequence

42 - 

cugugcgugugacagcggcuaa

 - 63

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:26548531 "Identification of microRNAs and microRNA targets in Xenopus gastrulae: The role of miR-26 in the regulation of Smad1" Liu C, Lou CH, Shah V, Ritter R, Talley J, Soibam B, Benham A, Zhu H, Perez E, Shieh YE, Gunaratne PH, Sater AK Dev Biol. 409:26-38(2016).