Stem-loop sequence bta-mir-374c

AccessionMI0038218 (change log)
DescriptionBos taurus miR-374c stem-loop
Literature search

3 open access papers mention bta-mir-374c
(3 sentences)

Stem-loop
   --   c                  cu 
5'   uua aauacaaccugauaagug  g
     ||| ||||||||||||||||||   
3'   aau uuauguuggacuauucac  u
   gu   a                  aa 
Get sequence
Deep sequencing
11504 reads, 98.6 reads per million, 74 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Btau_5.0.1; GCA_000003205.6) Overlapping transcripts
chrX: 82917575-82917626 [-]
intergenic
Clustered miRNAs
< 10kb from bta-mir-374c
bta-mir-545chrX: 82917716-82917821 [+]
bta-mir-374cchrX: 82917575-82917626 [-]
bta-mir-374achrX: 82917566-82917637 [+]
Database links

Mature sequence bta-miR-374c

Accession MIMAT0046394
Sequence

1 - 

uuacaauacaaccugauaagu

 - 21

Get sequence
Deep sequencing4736 reads, 74 experiments
Evidence experimental; Illumina [1]

References

1
PMID:27100870 "Comparative Analysis of the miRNome of Bovine Milk Fat, Whey and Cells" Li R, Dudemaine PL, Zhao X, Lei C, Ibeagha-Awemu EM PLoS One. 11:e0154129(2016).