Stem-loop sequence bta-mir-2285bj-2

AccessionMI0038216 (change log)
DescriptionBos taurus miR-2285bj-2 stem-loop
Literature search

11 open access papers mention bta-mir-2285bj-2
(15 sentences)

Stem-loop
   --        ug     aucaua 
5'   aaaaaguu  uucgg      u
     ||||||||  |||||      g
3'   uuuuucaa  aaguc      g
   gg        gu     ccaacc 
Get sequence
Deep sequencing
1080 reads, 11.6 reads per million, 69 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Btau_5.0.1; GCA_000003205.6) Overlapping transcripts
chr3: 86005621-86005667 [+]
intergenic
Database links

Mature sequence bta-miR-2285bj

Accession MIMAT0046391
Sequence

26 - 

caacccugaaugaacuuuuugg

 - 47

Get sequence
Deep sequencing2134 reads, 69 experiments
Evidence experimental; Illumina [1]

References

1
PMID:27100870 "Comparative Analysis of the miRNome of Bovine Milk Fat, Whey and Cells" Li R, Dudemaine PL, Zhao X, Lei C, Ibeagha-Awemu EM PLoS One. 11:e0154129(2016).