Stem-loop sequence bta-mir-2285bj-1

AccessionMI0038215 (change log)
DescriptionBos taurus miR-2285bj-1 stem-loop
Literature search

11 open access papers mention bta-mir-2285bj-1
(15 sentences)

Stem-loop
   --        ug      uauuua   cag 
5'   aaaaaguu  uucagg      cau   a
     ||||||||  ||||||      |||    
3'   uuuuucaa  aagucc      gua   u
   gg        gu      -caaca   uug 
Get sequence
Deep sequencing
1178 reads, 23.2 reads per million, 69 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Btau_5.0.1; GCA_000003205.6) Overlapping transcripts
chrX: 6590609-6590667 [-]
intergenic
Database links

Mature sequence bta-miR-2285bj

Accession MIMAT0046391
Sequence

38 - 

caacccugaaugaacuuuuugg

 - 59

Get sequence
Deep sequencing2134 reads, 69 experiments
Evidence experimental; Illumina [1]

References

1
PMID:27100870 "Comparative Analysis of the miRNome of Bovine Milk Fat, Whey and Cells" Li R, Dudemaine PL, Zhao X, Lei C, Ibeagha-Awemu EM PLoS One. 11:e0154129(2016).