Stem-loop sequence bta-mir-2285bi-2

AccessionMI0038214 (change log)
DescriptionBos taurus miR-2285bi-2 stem-loop
Literature search

11 open access papers mention bta-mir-2285bi-2
(15 sentences)

Stem-loop
   ---         gc         cc    ag 
5'    aaaaaguuu  uuggguuuu  caua  a
      |||||||||  |||||||||  ||||   
3'    uuuuucaag  gacccgaaa  guau  u
   cgg         ua         aa    cg 
Get sequence
Deep sequencing
325 reads, 5.36 reads per million, 56 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence bta-miR-2285bi

Accession MIMAT0046389
Sequence

40 - 

aagcccagaugaacuuuuuggc

 - 61

Get sequence
Deep sequencing270 reads, 43 experiments
Evidence experimental; Illumina [1]

References

1
PMID:27100870 "Comparative Analysis of the miRNome of Bovine Milk Fat, Whey and Cells" Li R, Dudemaine PL, Zhao X, Lei C, Ibeagha-Awemu EM PLoS One. 11:e0154129(2016).