Stem-loop sequence bta-mir-2285bh

AccessionMI0038212 (change log)
DescriptionBos taurus miR-2285bh stem-loop
Literature search

11 open access papers mention bta-mir-2285bh
(15 sentences)

Stem-loop
   --   gg      c  -g          c 
5'   aaa  uucguu gg  uuuuucugug a
     |||  |||||| ||  |||||||||| g
3'   uuu  aaguaa cc  aaaaagacau c
   gu   ga      a  aa          c 
Get sequence
Deep sequencing
6219 reads, 15.4 reads per million, 65 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Btau_5.0.1; GCA_000003205.6) Overlapping transcripts
chr9: 62536876-62536933 [-]
intergenic
Database links

Mature sequence bta-miR-2285bh

Accession MIMAT0046388
Sequence

1 - 

aaagguucguucggguuuuucu

 - 22

Get sequence
Deep sequencing6219 reads, 65 experiments
Evidence experimental; Illumina [1]

References

1
PMID:27100870 "Comparative Analysis of the miRNome of Bovine Milk Fat, Whey and Cells" Li R, Dudemaine PL, Zhao X, Lei C, Ibeagha-Awemu EM PLoS One. 11:e0154129(2016).