Stem-loop sequence bta-mir-11987

AccessionMI0038211 (change log)
DescriptionBos taurus miR-11987 stem-loop
Stem-loop
   --c    aauc   g   g      --a   cag          gca 
5'    gagg    ucu gug agguau   ugu   caguggcccu   g
      ||||    ||| ||| ||||||   |||   ||||||||||    
3'    uucc    agg uac uccgug   acg   gucaccgggg   g
   guu    ----   g   g      acg   uga          uug 
Get sequence
Deep sequencing
465 reads, 4.55 reads per million, 44 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Btau_5.0.1; GCA_000003205.6) Overlapping transcripts
chr9: 7483895-7483982 [+]
intergenic
Database links

Mature sequence bta-miR-11987

Accession MIMAT0046387
Sequence

1 - 

cgaggaaucucugguggaggu

 - 21

Get sequence
Deep sequencing460 reads, 45 experiments
Evidence experimental; Illumina [1]

References

1
PMID:27100870 "Comparative Analysis of the miRNome of Bovine Milk Fat, Whey and Cells" Li R, Dudemaine PL, Zhao X, Lei C, Ibeagha-Awemu EM PLoS One. 11:e0154129(2016).