Stem-loop sequence bta-mir-2285bg

AccessionMI0038210 (change log)
DescriptionBos taurus miR-2285bg stem-loop
Literature search

11 open access papers mention bta-mir-2285bg
(15 sentences)

Stem-loop
   --         c       - uu      g 
5'   aaaaguuug uuggguu u  cuguaa a
     ||||||||| ||||||| |  ||||||  
3'   uuuucaagc agcccaa g  gacauu u
   gu         a       a gg      g 
Get sequence
Deep sequencing
3005 reads, 17.5 reads per million, 40 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Btau_5.0.1; GCA_000003205.6) Overlapping transcripts
chr8: 36341603-36341661 [+]
intergenic
Database links

Mature sequence bta-miR-2285bg

Accession MIMAT0046386
Sequence

40 - 

aaacccgaacgaacuuuuug

 - 59

Get sequence
Deep sequencing2931 reads, 28 experiments
Evidence experimental; Illumina [1]

References

1
PMID:27100870 "Comparative Analysis of the miRNome of Bovine Milk Fat, Whey and Cells" Li R, Dudemaine PL, Zhao X, Lei C, Ibeagha-Awemu EM PLoS One. 11:e0154129(2016).