Stem-loop sequence bta-mir-11986

AccessionMI0038209 (change log)
DescriptionBos taurus miR-11986 stem-loop
Stem-loop
   -----uug       ag  a   -   ca 
5'         uccaaug  uu guc cuu  c
           |||||||  || ||| |||   
3'         agguuau  aa cgg gga  a
   cgacuuug       ga  c   u   cu 
Get sequence
Deep sequencing
1703 reads, 8.45 reads per million, 71 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Btau_5.0.1; GCA_000003205.6) Overlapping transcripts
chr7: 1886477-1886530 [-]
intergenic
Database links

Mature sequence bta-miR-11986

Accession MIMAT0046385
Sequence

1 - 

uuguccaaugaguuaguccuu

 - 21

Get sequence
Deep sequencing1677 reads, 71 experiments
Evidence experimental; Illumina [1]

References

1
PMID:27100870 "Comparative Analysis of the miRNome of Bovine Milk Fat, Whey and Cells" Li R, Dudemaine PL, Zhao X, Lei C, Ibeagha-Awemu EM PLoS One. 11:e0154129(2016).