Stem-loop sequence bta-mir-2285bf-2

AccessionMI0038207 (change log)
DescriptionBos taurus miR-2285bf-2 stem-loop
Literature search

11 open access papers mention bta-mir-2285bf-2
(15 sentences)

Stem-loop
   ---      c   g a    c     uac 
5'    aaaguu guu g guuu ucugu   a
      |||||| ||| | |||| |||||    
3'    uuucaa caa c caaa agaca   u
   guu      a   g a    a     ugu 
Get sequence
Deep sequencing
579 reads, 0 reads per million, 64 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Btau_5.0.1; GCA_000003205.6) Overlapping transcripts
chrX: 127008224-127008280 [-]
intergenic
Database links

Mature sequence bta-miR-2285bf

Accession MIMAT0046382
Sequence

37 - 

aaaacacgaacaaacuuuuug

 - 57

Get sequence
Deep sequencing1731 reads, 64 experiments
Evidence experimental; Illumina [1]

References

1
PMID:27100870 "Comparative Analysis of the miRNome of Bovine Milk Fat, Whey and Cells" Li R, Dudemaine PL, Zhao X, Lei C, Ibeagha-Awemu EM PLoS One. 11:e0154129(2016).