Stem-loop sequence bta-mir-2285bf-1

AccessionMI0038206 (change log)
DescriptionBos taurus miR-2285bf-1 stem-loop
Literature search

11 open access papers mention bta-mir-2285bf-1
(15 sentences)

Stem-loop
   --aaac   c    ag        ag  u 
5'       guu guuc  guuuuucu  aa a
         ||| ||||  ||||||||  ||  
3'       caa caag  caaaagga  uu u
   guuuuu   a    ca        cg  u 
Get sequence
Deep sequencing
1029 reads, 18.9 reads per million, 74 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Btau_5.0.1; GCA_000003205.6) Overlapping transcripts
chr6: 95061371-95061428 [+]
intergenic
Database links

Mature sequence bta-miR-2285bf

Accession MIMAT0046382
Sequence

38 - 

aaaacacgaacaaacuuuuug

 - 58

Get sequence
Deep sequencing1731 reads, 64 experiments
Evidence experimental; Illumina [1]

References

1
PMID:27100870 "Comparative Analysis of the miRNome of Bovine Milk Fat, Whey and Cells" Li R, Dudemaine PL, Zhao X, Lei C, Ibeagha-Awemu EM PLoS One. 11:e0154129(2016).