Stem-loop sequence bta-mir-11985

AccessionMI0038205 (change log)
DescriptionBos taurus miR-11985 stem-loop
Stem-loop
   --u          -  c     a 
5'    ggggggaggg gg ggguc g
      |||||||||| || |||||  
3'    cccuccucuc cc cccgg a
   ccg          g  a     c 
Get sequence
Deep sequencing
1404 reads, 3.45 reads per million, 58 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Btau_5.0.1; GCA_000003205.6) Overlapping transcripts
chr5: 115840004-115840048 [-]
intergenic
Database links

Mature sequence bta-miR-11985

Accession MIMAT0046381
Sequence

26 - 

cccaccgcucuccucccgcc

 - 45

Get sequence
Deep sequencing1404 reads, 58 experiments
Evidence experimental; Illumina [1]

References

1
PMID:27100870 "Comparative Analysis of the miRNome of Bovine Milk Fat, Whey and Cells" Li R, Dudemaine PL, Zhao X, Lei C, Ibeagha-Awemu EM PLoS One. 11:e0154129(2016).