Stem-loop sequence bta-mir-2285be

AccessionMI0038204 (change log)
DescriptionBos taurus miR-2285be stem-loop
Literature search

11 open access papers mention bta-mir-2285be
(15 sentences)

Stem-loop
   --        ca            cu   g 
5'   aaaagguu  uucggguuuuuc  uaa a
     ||||||||  ||||||||||||  |||  
3'   uuuuucaa  gagcucaaaaag  auu u
   gg        ac            ac   g 
Get sequence
Deep sequencing
1472 reads, 0 reads per million, 46 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Btau_5.0.1; GCA_000003205.6) Overlapping transcripts
chr5: 94992975-94993034 [+]
intergenic
Database links

Mature sequence bta-miR-2285be

Accession MIMAT0046380
Sequence

39 - 

aaaacucgagcaaacuuuuugg

 - 60

Get sequence
Deep sequencing36 reads, 21 experiments
Evidence experimental; Illumina [1]

References

1
PMID:27100870 "Comparative Analysis of the miRNome of Bovine Milk Fat, Whey and Cells" Li R, Dudemaine PL, Zhao X, Lei C, Ibeagha-Awemu EM PLoS One. 11:e0154129(2016).