Stem-loop sequence bta-mir-2285bc

AccessionMI0038201 (change log)
DescriptionBos taurus miR-2285bc stem-loop
Literature search

11 open access papers mention bta-mir-2285bc
(15 sentences)

Stem-loop
   --      u     ug     c   augcc 
5'   aaaagg ucauu  gguuu ucc     a
     |||||| |||||  ||||| |||      
3'   uuuucc aguaa  ccaaa agg     u
   gg      c     gu     a   cauuc 
Get sequence
Deep sequencing
821 reads, 0 reads per million, 64 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Btau_5.0.1; GCA_000003205.6) Overlapping transcripts
chr3: 94893283-94893342 [+]
intergenic
Database links

Mature sequence bta-miR-2285bc

Accession MIMAT0046377
Sequence

38 - 

aaaaaccugaaugacccuuuugg

 - 60

Get sequence
Deep sequencing627 reads, 64 experiments
Evidence experimental; Illumina [1]

References

1
PMID:27100870 "Comparative Analysis of the miRNome of Bovine Milk Fat, Whey and Cells" Li R, Dudemaine PL, Zhao X, Lei C, Ibeagha-Awemu EM PLoS One. 11:e0154129(2016).