Stem-loop sequence bta-mir-2285bb

AccessionMI0038199 (change log)
DescriptionBos taurus miR-2285bb stem-loop
Literature search

11 open access papers mention bta-mir-2285bb
(15 sentences)

Stem-loop
   ---       ug  g            cac 
5'    gaaaguu  uu ggguuuuucugu   a
      |||||||  || ||||||||||||    
3'    uuuucaa  aa cccgaaaagaca   u
   ggu       gu  a            auu 
Get sequence
Deep sequencing
1826 reads, 5 reads per million, 60 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Btau_5.0.1; GCA_000003205.6) Overlapping transcripts
chr3: 2867004-2867062 [+]
intergenic
Database links

Mature sequence bta-miR-2285bb

Accession MIMAT0046375
Sequence

1 - 

gaaaguuuguugggguuuuucu

 - 22

Get sequence
Deep sequencing1770 reads, 57 experiments
Evidence experimental; Illumina [1]

References

1
PMID:27100870 "Comparative Analysis of the miRNome of Bovine Milk Fat, Whey and Cells" Li R, Dudemaine PL, Zhao X, Lei C, Ibeagha-Awemu EM PLoS One. 11:e0154129(2016).