Stem-loop sequence bta-mir-2285ba-2

AccessionMI0038198 (change log)
DescriptionBos taurus miR-2285ba-2 stem-loop
Literature search

11 open access papers mention bta-mir-2285ba-2
(15 sentences)

Stem-loop
   --       g a     au   g     ag 
5'   aaaaagu c uucag  uuu ccaua  a
     ||||||| | |||||  ||| |||||   
3'   uuuuuca g aaguc  aaa gguau  g
   gg       a c     cc   a     gc 
Get sequence
Deep sequencing
3578 reads, 13.1 reads per million, 61 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Btau_5.0.1; GCA_000003205.6) Overlapping transcripts
chr15: 21810638-21810697 [-]
intergenic
Database links

Mature sequence bta-miR-2285ba

Accession MIMAT0046373
Sequence

39 - 

aaacccugaacgaacuuuuugg

 - 60

Get sequence
Deep sequencing7152 reads, 61 experiments
Evidence experimental; Illumina [1]

References

1
PMID:27100870 "Comparative Analysis of the miRNome of Bovine Milk Fat, Whey and Cells" Li R, Dudemaine PL, Zhao X, Lei C, Ibeagha-Awemu EM PLoS One. 11:e0154129(2016).