Stem-loop sequence bta-mir-2285ba-1

AccessionMI0038197 (change log)
DescriptionBos taurus miR-2285ba-1 stem-loop
Literature search

11 open access papers mention bta-mir-2285ba-1
(15 sentences)

Stem-loop
   ---               u  c    ag 
5'    aaaaguuuguucagg uu ugua  a
      ||||||||||||||| || ||||   
3'    uuuucaagcaagucc aa acgu  u
   ggu               c  a    gg 
Get sequence
Deep sequencing
3619 reads, 14.1 reads per million, 64 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Btau_5.0.1; GCA_000003205.6) Overlapping transcripts
chr28: 33644318-33644372 [-]
intergenic
Database links

Mature sequence bta-miR-2285ba

Accession MIMAT0046373
Sequence

34 - 

aaacccugaacgaacuuuuugg

 - 55

Get sequence
Deep sequencing7152 reads, 61 experiments
Evidence experimental; Illumina [1]

References

1
PMID:27100870 "Comparative Analysis of the miRNome of Bovine Milk Fat, Whey and Cells" Li R, Dudemaine PL, Zhao X, Lei C, Ibeagha-Awemu EM PLoS One. 11:e0154129(2016).