Stem-loop sequence bta-mir-11982

AccessionMI0038196 (change log)
DescriptionBos taurus miR-11982 stem-loop
Stem-loop
   -uuc    ccac     u     uc   cu ua 
5'     ggcg    caccc gcggg  gcg  g  a
       ||||    ||||| |||||  |||  |   
3'     ccgc    guggg cgccc  cgu  c  g
   ccac    --uu     -     --   -u ua 
Get sequence
Deep sequencing
59 reads, 0 reads per million, 41 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Btau_5.0.1; GCA_000003205.6) Overlapping transcripts
chr28: 8651548-8651608 [-]
intergenic
Database links

Mature sequence bta-miR-11982

Accession MIMAT0046372
Sequence

1 - 

uucggcgccaccacccugcgggu

 - 23

Get sequence
Deep sequencing59 reads, 41 experiments
Evidence experimental; Illumina [1]

References

1
PMID:27100870 "Comparative Analysis of the miRNome of Bovine Milk Fat, Whey and Cells" Li R, Dudemaine PL, Zhao X, Lei C, Ibeagha-Awemu EM PLoS One. 11:e0154129(2016).