Stem-loop sequence bta-mir-9851

AccessionMI0038195 (change log)
DescriptionBos taurus miR-9851 stem-loop
Stem-loop
   -     g           g    u  gu 
5'  cgcug caguguuggug cacu gc  g
    ||||| ||||||||||| |||| ||   
3'  guggc gucacgaccac gugg cg  g
   g     g           g    -  gg 
Get sequence
Deep sequencing
16 reads, 0 reads per million, 15 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Btau_5.0.1; GCA_000003205.6) Overlapping transcripts
chr26: 37733899-37733954 [-]
intergenic
Database links

Mature sequence bta-miR-9851

Accession MIMAT0046371
Sequence

36 - 

uggcaccagcacuggcggugg

 - 56

Get sequence
Deep sequencing14 reads, 13 experiments
Evidence experimental; Illumina [1]

References

1
PMID:27100870 "Comparative Analysis of the miRNome of Bovine Milk Fat, Whey and Cells" Li R, Dudemaine PL, Zhao X, Lei C, Ibeagha-Awemu EM PLoS One. 11:e0154129(2016).