Stem-loop sequence bta-mir-11981

AccessionMI0038194 (change log)
DescriptionBos taurus miR-11981 stem-loop
Stem-loop
   --c       ga   g   ---g g  ag   g   g 
5'    agggcgg  acg gcu    c gg  gcu cug g
      |||||||  ||| |||    | ||  ||| |||  
3'    ucccgcu  ugc ugg    g cc  cga ggc g
   cuu       ag   g   acag g  -g   g   c 
Get sequence
Deep sequencing
10 reads, 0 reads per million, 5 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Btau_5.0.1; GCA_000003205.6) Overlapping transcripts
chr26: 33182606-33182675 [-]
intergenic
Database links

Mature sequence bta-miR-11981

Accession MIMAT0046370
Sequence

1 - 

cagggcgggaacgggcugcggga

 - 23

Get sequence
Deep sequencing2 reads, 2 experiments
Evidence experimental; Illumina [1]

References

1
PMID:27100870 "Comparative Analysis of the miRNome of Bovine Milk Fat, Whey and Cells" Li R, Dudemaine PL, Zhao X, Lei C, Ibeagha-Awemu EM PLoS One. 11:e0154129(2016).