Stem-loop sequence bta-mir-6715

AccessionMI0038193 (change log)
DescriptionBos taurus miR-6715 stem-loop
Stem-loop
   ---           ca     a   u   c 
5'    acaggcacggc  guuug gca uuu a
      |||||||||||  ||||| ||| |||  
3'    uguccguguug  caaac cgu aag c
   aga           ac     -   u   u 
Get sequence
Deep sequencing
181 reads, 51.4 reads per million, 37 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Btau_5.0.1; GCA_000003205.6) Overlapping transcripts
chr26: 33286345-33286402 [+]
intergenic
Database links

Mature sequence bta-miR-6715

Accession MIMAT0046369
Sequence

1 - 

acaggcacggccaguuugagc

 - 21

Get sequence
Deep sequencing15 reads, 9 experiments
Evidence experimental; Illumina [1]

References

1
PMID:27100870 "Comparative Analysis of the miRNome of Bovine Milk Fat, Whey and Cells" Li R, Dudemaine PL, Zhao X, Lei C, Ibeagha-Awemu EM PLoS One. 11:e0154129(2016).