Stem-loop sequence bta-mir-11980

AccessionMI0038192 (change log)
DescriptionBos taurus miR-11980 stem-loop
Stem-loop
   ----   c        -u  c    g uu 
5'     agg aacgggcu  gg ggag c  g
       ||| ||||||||  || |||| |  u
3'     ucc uugcccga  cc ccuc g  c
   cgag   c        uu  u    - cc 
Get sequence
Deep sequencing
562 reads, 0 reads per million, 19 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Btau_5.0.1; GCA_000003205.6) Overlapping transcripts
chr25: 41407039-41407093 [-]
intergenic
Database links

Mature sequence bta-miR-11980

Accession MIMAT0046368
Sequence

1 - 

aggcaacgggcuuggcggag

 - 20

Get sequence
Deep sequencing560 reads, 17 experiments
Evidence experimental; Illumina [1]

References

1
PMID:27100870 "Comparative Analysis of the miRNome of Bovine Milk Fat, Whey and Cells" Li R, Dudemaine PL, Zhao X, Lei C, Ibeagha-Awemu EM PLoS One. 11:e0154129(2016).