Stem-loop sequence bta-mir-2285aq-2

AccessionMI0038190 (change log)
DescriptionBos taurus miR-2285aq-2 stem-loop
Literature search

11 open access papers mention bta-mir-2285aq-2
(15 sentences)

Stem-loop
   -            caa     c     ac 
5'  aaaaaguucauu   guuuu cugua  a
    ||||||||||||   ||||| |||||   
3'  uuuuucaaguag   cgaaa gguau  u
   g            acc     a     gc 
Get sequence
Deep sequencing
144 reads, 0 reads per million, 33 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Btau_5.0.1; GCA_000003205.6) Overlapping transcripts
chr12: 81293022-81293080 [-]
intergenic
Database links

Mature sequence bta-miR-2285aq

Accession MIMAT0046365
Sequence

40 - 

aagcccagaugaacuuuuug

 - 59

Get sequence
Deep sequencing152 reads, 8 experiments
Evidence experimental; Illumina [1]

References

1
PMID:27100870 "Comparative Analysis of the miRNome of Bovine Milk Fat, Whey and Cells" Li R, Dudemaine PL, Zhao X, Lei C, Ibeagha-Awemu EM PLoS One. 11:e0154129(2016).