Stem-loop sequence bta-mir-11978

AccessionMI0038188 (change log)
DescriptionBos taurus miR-11978 stem-loop
Stem-loop
   ac       ucc      c   -   cuc 
5'   ucuuccc   cucggc ggc gcu   g
     |||||||   |||||| ||| |||   c
3'   aggaggg   gggccg ccg cgg   g
   ga       uca      a   u   cuu 
Get sequence
Deep sequencing
10 reads, 12.5 reads per million, 8 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Btau_5.0.1; GCA_000003205.6) Overlapping transcripts
chr2: 31620968-31621027 [-]
intergenic
Database links

Mature sequence bta-miR-11978

Accession MIMAT0046364
Sequence

1 - 

acucuucccucccucggccggc

 - 22

Get sequence
Deep sequencing9 reads, 9 experiments
Evidence experimental; Illumina [1]

References

1
PMID:27100870 "Comparative Analysis of the miRNome of Bovine Milk Fat, Whey and Cells" Li R, Dudemaine PL, Zhao X, Lei C, Ibeagha-Awemu EM PLoS One. 11:e0154129(2016).